451 Recombinant Proteins and Cell culture

LexA | LexA repressor (protein, positive control) | AS21 4541P

(No reviews yet) Write a Review
SKU:
451-AS21 4541P
Availability:
Usually ships in 5 working days
£1,212.00

Description

LexA | LexA repressor (protein, positive control) | AS21 4541P | Gentaur UK, US & Europe Distribution

Immunogen: N/A

Host: N/A

Conjugation: N/A

Clonality: N/A

Isotype: N/A

Purity: Contains 50% glycerol, 10 mM Tris-HCl (pH 7, 5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT. Over 90 % pure by SDS-PAGE.

Format: Liquid

Tested Application: Western blot (WB)

Related Products: AS21 4541 | Anti-LexA | LexA repressor, rabbit anitbodies

Recommended Dilutions: N/A

Molecular weight: 22, 3 | 23 kDa

Confirmed Reactivity: N/A

Predicted Reactivity: N/A

Not reactive in: N/A

Additional Information: LexA protein is full length, highly purified (over 90 %, SDS-PAGE) provided at a concentration of 1 mg/ml estimated by BCA method. UniProt: P0A7C2

Background: Escherichia coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA) . LexA's self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the S

Reconstitution: N/A

Storage: Store at -20°C or -80°C for a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.

TAIR Nnumbre: N/A

Category: Bacteria

Research Area: N/A

View AllClose

Additional Information

Size:
20 µg
View AllClose