26

pGB Hsp90 siRNA Vector Mix | 9518

(No reviews yet) Write a Review
SKU:
26-9518-GEN
Availability:
Usually shipped in 5 working days
NULL994.00

Description

pGB expression vectors contain the human U6 RNA polymerase III promoter, which directs constitutive, high-level expression of short RNA transcripts in many cells. Each vector also contains the neomycin/kanamycin-resistance gene to provide kanamycin resistance in bacteria and the G418 resistance in mammalian cells. In addition, pGB Cloning vector which is used to clone your own insert and pGB Negative Control vector which contains an insert that does not have significant homology to mammalian genes expressed in human, mouse, and rat, and therefore can be used as a negative control for pGB-expression vectors. The pGB siRNA vectors are designed to suppress the expression of some of the most important apoptosis genes, individually. The mix of four siRNA vectors for each gene has been proven more efficient for gene suppression.

9518 | pGB Hsp90 siRNA Vector Mix DataSheet

Sort Name: pGB Hsp90 siRNA Vector Mix

Label Name: N/A

Taglines: pGB expression vector to supress Hsp90 activity in transfected cells

Product Highlights: • GeneBlocker™ Hsp90 alpha siRNA Vector Mix • Application- The pGB siRNA vector Mix (1 µg/µl) can be transfected into mammalian cells using Lipofectamine (Invitrogen). For transient transfection, cells can be analyzed in 24-96 hours following transfections, by Western blot analysis or other detection means. For stable transfections, cells can be selected in G418 selection medium to obtain stable cell lines with the specific gene blocked. • Features and Positions: Human U6 Promoter: 1-256 Multiple cloning Site: 259-285 3’ Primer: 398-426 (GAAGCATTTATCAGGGTTATTGTCTCATG) SV40 Promoter: 470-808 Neomycin/Kanamycin Resistance ORF: 843-1634 5’ Primer: 2789-2813 (CGTCGATTTTTGTGATGCTCGTCAG) pUC Origin of Replication: 2222-3003

Packaging: EA

View AllClose

Additional Information

Storage Temperature:
-20°C
Shipping:
Gel Pack
Shelf Life:
12 months
View AllClose