26

siRNA Cloning Vector (pGB) | 9500

(No reviews yet) Write a Review
SKU:
26-9500-GEN
Availability:
Usually shipped in 5 working days
NULL552.00
Frequently bought together:

Description

pGB expression vectors contain the human U6 RNA polymerase III promoter, which directs constitutive, high-level expression of short RNA transcripts in many cells. Each vector also contains the neomycin/kanamycin-resistance gene to provide kanamycin resistance in bacteria and the G418 resistance in mammalian cells. The pGB vector is used to clone your own insert. The vector contains two unique restriction sites, BamH I and Xba I for directional cloning. The pGB Negative Control vector contains a insert that does not have significant homology to mammalian genes expressed in human, mouse, and rat, and it can be used as a negative control for pGB-Caspase siRNA vectors. The pGB Caspase siRNA vectors contain the siRNA inserts designed to suppress the expression of each caspase individually

9500 | siRNA Cloning Vector (pGB) DataSheet

Sort Name: siRNA Cloning Vector (pGB)

Label Name: N/A

Taglines: pGB expression vector containing the human U6 RNA polymerase III promoter and BamH I and Xba I sites for directional cloning.

Product Highlights: • (GeneBlocker™ siRNA Cloning Vector, pGB) • Application- The pGB siRNA vectors can be transfected into mammalian cells using Lipofectamine (Invitrogen). For transient transfection, cells can be analyzed in 24-96 hours following transfections, by Western blot analysis or other detection means. For stable transfections, cells can be selected in G418 selection medium to obtain stable cell lines with the specific gene blocked.The pGB cloning vector is designed for cloning your own siRNA insert. • Features and Positions: Human U6 Promoter: 1-256 Multiple cloning Site: 259-285 3’ Primer: 398-426 (GAAGCATTTATCAGGGTTATTGTCTCATG) SV40 Promoter: 470-808 Neomycin/Kanamycin Resistance ORF: 843-1634 5’ Primer: 2789-2813 (CGTCGATTTTTGTGATGCTCGTCAG) pUC Origin of Replication: 2222-3003

Packaging: EA

View AllClose

Additional Information

Storage Temperature:
-20°C
Shipping:
Gel Pack
Shelf Life:
12 months
View AllClose